Microarray:
Article Title: Superstructure of the centromeric complex of TubZR C plasmid partitioning systems
Article Snippet: .. Briefly, all proteins were produced in E. coli and purified by chromatography; DNA was either synthesized ( Bt tubC 24), produced by PCR (all other linear DNA), or purified as a plasmid (p tubC ); the Bt tubC aptamer microarray experiment was performed in conjunction with LC Sciences; electron microscopy was carried out using a 2% (wt/vol) uranyl acetate negative stain in an FEI T12 electron microscope; the sequence of Bt tubC 24 was TTTAAGTTTAACTTTCAGTTTACA; Bt TubR C 24 crystals were solved at 7 Å by molecular replacement and confirmed by selenomethionine SAD, whereas Bm TubR crystals were solved at 3.5 Å by selenomethionine SAD; 90° light scattering was carried out at 400 nm using 1.25 μM Bt TubZ, 500 nM TubR, and 125 nM of TubR binding sites in each tubC DNA, except for tubC repeats 4–7, where the concentration was doubled to make the difference from tubC 24 clearly visible. .. We thank Rachel Larsen, Joseph Pogliano (both University of California at San Diego), and Katherine Michie [Medical Research Council Laboratory of Molecular Biology (MRC-LMB)] for providing materials; Sebastian Eustermann (MRC-LMB) for his tetraloop sequence; Fabrice Gorrec and Sonja Kuhlman for their help at MRC-LMB crystallization facility; Chen Shaoxia, Qing Wang, and Colin Palmer for their aid with electron microscopy at MRC-LMB; Sonja Dunbar for summer work and Ramona Duman (both MRC-LMB) for help at the European Synchrotron Radiation Facility (ESRF); and LC Sciences, the ESRF, and Diamond Light Source for their excellent service and support.
Article Title: MicroRNAs That Contribute to Coordinating the Immune Response in Drosophila melanogaster
Article Snippet: At 0, 1, 7.5, 18, and 60 hr following injection, total RNA was purified from 10 females using the Total RNA Purification Plus Kit (Cat. No. 48400; Norgen Biotek). .. Next, 5 μg of total RNA (quantified using a NanoDrop 1000 spectrophotometer) from each sample was suspended in 200 μl of precipitation solution (3 M NaOAc, pH 5.2 and 100% ethanol) and immediately frozen in liquid nitrogen; these were stored at −80° until shipment for the miRNA microarray experiment (LC Sciences, Houston, TX). ..
Article Title: Microarray-based identification of conserved microRNAs from Pinellia ternata.
Article Snippet: Contents lists available at SciVerse ScienceDirect Gene j ourna l homepage: www.e lsev ie r .com/ locate /gene Microarray-based identification of conserved microRNAs from Pinellia ternata Tao Xu a,1, Bo Wang a,1, Xuefeng Liu a, Ruijuan Feng a, Miao Dong a, Jishuang Chen a,b,⁎ a College of Life Sciences, Zhejiang Sci-Tech University, Hangzhou 310018, China b Nanjing University of Technology, China Abbreviations: RT-PCR, reverse transcription polyme Quantitative real-time polymerase chain reaction; P nucleotide mismatch; SSPE, saline–sodium phosphate–e ⁎ Corresponding author at: College of Life Sciences, Hangzhou 310018, China.. E-mail address: chenjs@zstu.edu.cn (J. Chen).. 1 These authors contributed equally to this work.
Produced:Article Title: Superstructure of the centromeric complex of TubZR C plasmid partitioning systems
Article Snippet: .. Briefly, all proteins were produced in E. coli and purified by chromatography; DNA was either synthesized ( Bt tubC 24), produced by PCR (all other linear DNA), or purified as a plasmid (p tubC ); the Bt tubC aptamer microarray experiment was performed in conjunction with LC Sciences; electron microscopy was carried out using a 2% (wt/vol) uranyl acetate negative stain in an FEI T12 electron microscope; the sequence of Bt tubC 24 was TTTAAGTTTAACTTTCAGTTTACA; Bt TubR C 24 crystals were solved at 7 Å by molecular replacement and confirmed by selenomethionine SAD, whereas Bm TubR crystals were solved at 3.5 Å by selenomethionine SAD; 90° light scattering was carried out at 400 nm using 1.25 μM Bt TubZ, 500 nM TubR, and 125 nM of TubR binding sites in each tubC DNA, except for tubC repeats 4–7, where the concentration was doubled to make the difference from tubC 24 clearly visible. .. We thank Rachel Larsen, Joseph Pogliano (both University of California at San Diego), and Katherine Michie [Medical Research Council Laboratory of Molecular Biology (MRC-LMB)] for providing materials; Sebastian Eustermann (MRC-LMB) for his tetraloop sequence; Fabrice Gorrec and Sonja Kuhlman for their help at MRC-LMB crystallization facility; Chen Shaoxia, Qing Wang, and Colin Palmer for their aid with electron microscopy at MRC-LMB; Sonja Dunbar for summer work and Ramona Duman (both MRC-LMB) for help at the European Synchrotron Radiation Facility (ESRF); and LC Sciences, the ESRF, and Diamond Light Source for their excellent service and support.
Purification:Article Title: Superstructure of the centromeric complex of TubZR C plasmid partitioning systems
Article Snippet: .. Briefly, all proteins were produced in E. coli and purified by chromatography; DNA was either synthesized ( Bt tubC 24), produced by PCR (all other linear DNA), or purified as a plasmid (p tubC ); the Bt tubC aptamer microarray experiment was performed in conjunction with LC Sciences; electron microscopy was carried out using a 2% (wt/vol) uranyl acetate negative stain in an FEI T12 electron microscope; the sequence of Bt tubC 24 was TTTAAGTTTAACTTTCAGTTTACA; Bt TubR C 24 crystals were solved at 7 Å by molecular replacement and confirmed by selenomethionine SAD, whereas Bm TubR crystals were solved at 3.5 Å by selenomethionine SAD; 90° light scattering was carried out at 400 nm using 1.25 μM Bt TubZ, 500 nM TubR, and 125 nM of TubR binding sites in each tubC DNA, except for tubC repeats 4–7, where the concentration was doubled to make the difference from tubC 24 clearly visible. .. We thank Rachel Larsen, Joseph Pogliano (both University of California at San Diego), and Katherine Michie [Medical Research Council Laboratory of Molecular Biology (MRC-LMB)] for providing materials; Sebastian Eustermann (MRC-LMB) for his tetraloop sequence; Fabrice Gorrec and Sonja Kuhlman for their help at MRC-LMB crystallization facility; Chen Shaoxia, Qing Wang, and Colin Palmer for their aid with electron microscopy at MRC-LMB; Sonja Dunbar for summer work and Ramona Duman (both MRC-LMB) for help at the European Synchrotron Radiation Facility (ESRF); and LC Sciences, the ESRF, and Diamond Light Source for their excellent service and support.
Chromatography:Article Title: Superstructure of the centromeric complex of TubZR C plasmid partitioning systems
Article Snippet: .. Briefly, all proteins were produced in E. coli and purified by chromatography; DNA was either synthesized ( Bt tubC 24), produced by PCR (all other linear DNA), or purified as a plasmid (p tubC ); the Bt tubC aptamer microarray experiment was performed in conjunction with LC Sciences; electron microscopy was carried out using a 2% (wt/vol) uranyl acetate negative stain in an FEI T12 electron microscope; the sequence of Bt tubC 24 was TTTAAGTTTAACTTTCAGTTTACA; Bt TubR C 24 crystals were solved at 7 Å by molecular replacement and confirmed by selenomethionine SAD, whereas Bm TubR crystals were solved at 3.5 Å by selenomethionine SAD; 90° light scattering was carried out at 400 nm using 1.25 μM Bt TubZ, 500 nM TubR, and 125 nM of TubR binding sites in each tubC DNA, except for tubC repeats 4–7, where the concentration was doubled to make the difference from tubC 24 clearly visible. .. We thank Rachel Larsen, Joseph Pogliano (both University of California at San Diego), and Katherine Michie [Medical Research Council Laboratory of Molecular Biology (MRC-LMB)] for providing materials; Sebastian Eustermann (MRC-LMB) for his tetraloop sequence; Fabrice Gorrec and Sonja Kuhlman for their help at MRC-LMB crystallization facility; Chen Shaoxia, Qing Wang, and Colin Palmer for their aid with electron microscopy at MRC-LMB; Sonja Dunbar for summer work and Ramona Duman (both MRC-LMB) for help at the European Synchrotron Radiation Facility (ESRF); and LC Sciences, the ESRF, and Diamond Light Source for their excellent service and support.
Synthesized:Article Title: Superstructure of the centromeric complex of TubZR C plasmid partitioning systems
Article Snippet: .. Briefly, all proteins were produced in E. coli and purified by chromatography; DNA was either synthesized ( Bt tubC 24), produced by PCR (all other linear DNA), or purified as a plasmid (p tubC ); the Bt tubC aptamer microarray experiment was performed in conjunction with LC Sciences; electron microscopy was carried out using a 2% (wt/vol) uranyl acetate negative stain in an FEI T12 electron microscope; the sequence of Bt tubC 24 was TTTAAGTTTAACTTTCAGTTTACA; Bt TubR C 24 crystals were solved at 7 Å by molecular replacement and confirmed by selenomethionine SAD, whereas Bm TubR crystals were solved at 3.5 Å by selenomethionine SAD; 90° light scattering was carried out at 400 nm using 1.25 μM Bt TubZ, 500 nM TubR, and 125 nM of TubR binding sites in each tubC DNA, except for tubC repeats 4–7, where the concentration was doubled to make the difference from tubC 24 clearly visible. .. We thank Rachel Larsen, Joseph Pogliano (both University of California at San Diego), and Katherine Michie [Medical Research Council Laboratory of Molecular Biology (MRC-LMB)] for providing materials; Sebastian Eustermann (MRC-LMB) for his tetraloop sequence; Fabrice Gorrec and Sonja Kuhlman for their help at MRC-LMB crystallization facility; Chen Shaoxia, Qing Wang, and Colin Palmer for their aid with electron microscopy at MRC-LMB; Sonja Dunbar for summer work and Ramona Duman (both MRC-LMB) for help at the European Synchrotron Radiation Facility (ESRF); and LC Sciences, the ESRF, and Diamond Light Source for their excellent service and support.
Polymerase Chain Reaction:Article Title: Superstructure of the centromeric complex of TubZR C plasmid partitioning systems
Article Snippet: .. Briefly, all proteins were produced in E. coli and purified by chromatography; DNA was either synthesized ( Bt tubC 24), produced by PCR (all other linear DNA), or purified as a plasmid (p tubC ); the Bt tubC aptamer microarray experiment was performed in conjunction with LC Sciences; electron microscopy was carried out using a 2% (wt/vol) uranyl acetate negative stain in an FEI T12 electron microscope; the sequence of Bt tubC 24 was TTTAAGTTTAACTTTCAGTTTACA; Bt TubR C 24 crystals were solved at 7 Å by molecular replacement and confirmed by selenomethionine SAD, whereas Bm TubR crystals were solved at 3.5 Å by selenomethionine SAD; 90° light scattering was carried out at 400 nm using 1.25 μM Bt TubZ, 500 nM TubR, and 125 nM of TubR binding sites in each tubC DNA, except for tubC repeats 4–7, where the concentration was doubled to make the difference from tubC 24 clearly visible. .. We thank Rachel Larsen, Joseph Pogliano (both University of California at San Diego), and Katherine Michie [Medical Research Council Laboratory of Molecular Biology (MRC-LMB)] for providing materials; Sebastian Eustermann (MRC-LMB) for his tetraloop sequence; Fabrice Gorrec and Sonja Kuhlman for their help at MRC-LMB crystallization facility; Chen Shaoxia, Qing Wang, and Colin Palmer for their aid with electron microscopy at MRC-LMB; Sonja Dunbar for summer work and Ramona Duman (both MRC-LMB) for help at the European Synchrotron Radiation Facility (ESRF); and LC Sciences, the ESRF, and Diamond Light Source for their excellent service and support.
Plasmid Preparation:Article Title: Superstructure of the centromeric complex of TubZR C plasmid partitioning systems
Article Snippet: .. Briefly, all proteins were produced in E. coli and purified by chromatography; DNA was either synthesized ( Bt tubC 24), produced by PCR (all other linear DNA), or purified as a plasmid (p tubC ); the Bt tubC aptamer microarray experiment was performed in conjunction with LC Sciences; electron microscopy was carried out using a 2% (wt/vol) uranyl acetate negative stain in an FEI T12 electron microscope; the sequence of Bt tubC 24 was TTTAAGTTTAACTTTCAGTTTACA; Bt TubR C 24 crystals were solved at 7 Å by molecular replacement and confirmed by selenomethionine SAD, whereas Bm TubR crystals were solved at 3.5 Å by selenomethionine SAD; 90° light scattering was carried out at 400 nm using 1.25 μM Bt TubZ, 500 nM TubR, and 125 nM of TubR binding sites in each tubC DNA, except for tubC repeats 4–7, where the concentration was doubled to make the difference from tubC 24 clearly visible. .. We thank Rachel Larsen, Joseph Pogliano (both University of California at San Diego), and Katherine Michie [Medical Research Council Laboratory of Molecular Biology (MRC-LMB)] for providing materials; Sebastian Eustermann (MRC-LMB) for his tetraloop sequence; Fabrice Gorrec and Sonja Kuhlman for their help at MRC-LMB crystallization facility; Chen Shaoxia, Qing Wang, and Colin Palmer for their aid with electron microscopy at MRC-LMB; Sonja Dunbar for summer work and Ramona Duman (both MRC-LMB) for help at the European Synchrotron Radiation Facility (ESRF); and LC Sciences, the ESRF, and Diamond Light Source for their excellent service and support.
Electron Microscopy:Article Title: Superstructure of the centromeric complex of TubZR C plasmid partitioning systems
Article Snippet: .. Briefly, all proteins were produced in E. coli and purified by chromatography; DNA was either synthesized ( Bt tubC 24), produced by PCR (all other linear DNA), or purified as a plasmid (p tubC ); the Bt tubC aptamer microarray experiment was performed in conjunction with LC Sciences; electron microscopy was carried out using a 2% (wt/vol) uranyl acetate negative stain in an FEI T12 electron microscope; the sequence of Bt tubC 24 was TTTAAGTTTAACTTTCAGTTTACA; Bt TubR C 24 crystals were solved at 7 Å by molecular replacement and confirmed by selenomethionine SAD, whereas Bm TubR crystals were solved at 3.5 Å by selenomethionine SAD; 90° light scattering was carried out at 400 nm using 1.25 μM Bt TubZ, 500 nM TubR, and 125 nM of TubR binding sites in each tubC DNA, except for tubC repeats 4–7, where the concentration was doubled to make the difference from tubC 24 clearly visible. .. We thank Rachel Larsen, Joseph Pogliano (both University of California at San Diego), and Katherine Michie [Medical Research Council Laboratory of Molecular Biology (MRC-LMB)] for providing materials; Sebastian Eustermann (MRC-LMB) for his tetraloop sequence; Fabrice Gorrec and Sonja Kuhlman for their help at MRC-LMB crystallization facility; Chen Shaoxia, Qing Wang, and Colin Palmer for their aid with electron microscopy at MRC-LMB; Sonja Dunbar for summer work and Ramona Duman (both MRC-LMB) for help at the European Synchrotron Radiation Facility (ESRF); and LC Sciences, the ESRF, and Diamond Light Source for their excellent service and support.
Staining:Article Title: Superstructure of the centromeric complex of TubZR C plasmid partitioning systems
Article Snippet: .. Briefly, all proteins were produced in E. coli and purified by chromatography; DNA was either synthesized ( Bt tubC 24), produced by PCR (all other linear DNA), or purified as a plasmid (p tubC ); the Bt tubC aptamer microarray experiment was performed in conjunction with LC Sciences; electron microscopy was carried out using a 2% (wt/vol) uranyl acetate negative stain in an FEI T12 electron microscope; the sequence of Bt tubC 24 was TTTAAGTTTAACTTTCAGTTTACA; Bt TubR C 24 crystals were solved at 7 Å by molecular replacement and confirmed by selenomethionine SAD, whereas Bm TubR crystals were solved at 3.5 Å by selenomethionine SAD; 90° light scattering was carried out at 400 nm using 1.25 μM Bt TubZ, 500 nM TubR, and 125 nM of TubR binding sites in each tubC DNA, except for tubC repeats 4–7, where the concentration was doubled to make the difference from tubC 24 clearly visible. .. We thank Rachel Larsen, Joseph Pogliano (both University of California at San Diego), and Katherine Michie [Medical Research Council Laboratory of Molecular Biology (MRC-LMB)] for providing materials; Sebastian Eustermann (MRC-LMB) for his tetraloop sequence; Fabrice Gorrec and Sonja Kuhlman for their help at MRC-LMB crystallization facility; Chen Shaoxia, Qing Wang, and Colin Palmer for their aid with electron microscopy at MRC-LMB; Sonja Dunbar for summer work and Ramona Duman (both MRC-LMB) for help at the European Synchrotron Radiation Facility (ESRF); and LC Sciences, the ESRF, and Diamond Light Source for their excellent service and support.
Microscopy:Article Title: Superstructure of the centromeric complex of TubZR C plasmid partitioning systems
Article Snippet: .. Briefly, all proteins were produced in E. coli and purified by chromatography; DNA was either synthesized ( Bt tubC 24), produced by PCR (all other linear DNA), or purified as a plasmid (p tubC ); the Bt tubC aptamer microarray experiment was performed in conjunction with LC Sciences; electron microscopy was carried out using a 2% (wt/vol) uranyl acetate negative stain in an FEI T12 electron microscope; the sequence of Bt tubC 24 was TTTAAGTTTAACTTTCAGTTTACA; Bt TubR C 24 crystals were solved at 7 Å by molecular replacement and confirmed by selenomethionine SAD, whereas Bm TubR crystals were solved at 3.5 Å by selenomethionine SAD; 90° light scattering was carried out at 400 nm using 1.25 μM Bt TubZ, 500 nM TubR, and 125 nM of TubR binding sites in each tubC DNA, except for tubC repeats 4–7, where the concentration was doubled to make the difference from tubC 24 clearly visible. .. We thank Rachel Larsen, Joseph Pogliano (both University of California at San Diego), and Katherine Michie [Medical Research Council Laboratory of Molecular Biology (MRC-LMB)] for providing materials; Sebastian Eustermann (MRC-LMB) for his tetraloop sequence; Fabrice Gorrec and Sonja Kuhlman for their help at MRC-LMB crystallization facility; Chen Shaoxia, Qing Wang, and Colin Palmer for their aid with electron microscopy at MRC-LMB; Sonja Dunbar for summer work and Ramona Duman (both MRC-LMB) for help at the European Synchrotron Radiation Facility (ESRF); and LC Sciences, the ESRF, and Diamond Light Source for their excellent service and support.
Sequencing:Article Title: Superstructure of the centromeric complex of TubZR C plasmid partitioning systems
Article Snippet: .. Briefly, all proteins were produced in E. coli and purified by chromatography; DNA was either synthesized ( Bt tubC 24), produced by PCR (all other linear DNA), or purified as a plasmid (p tubC ); the Bt tubC aptamer microarray experiment was performed in conjunction with LC Sciences; electron microscopy was carried out using a 2% (wt/vol) uranyl acetate negative stain in an FEI T12 electron microscope; the sequence of Bt tubC 24 was TTTAAGTTTAACTTTCAGTTTACA; Bt TubR C 24 crystals were solved at 7 Å by molecular replacement and confirmed by selenomethionine SAD, whereas Bm TubR crystals were solved at 3.5 Å by selenomethionine SAD; 90° light scattering was carried out at 400 nm using 1.25 μM Bt TubZ, 500 nM TubR, and 125 nM of TubR binding sites in each tubC DNA, except for tubC repeats 4–7, where the concentration was doubled to make the difference from tubC 24 clearly visible. .. We thank Rachel Larsen, Joseph Pogliano (both University of California at San Diego), and Katherine Michie [Medical Research Council Laboratory of Molecular Biology (MRC-LMB)] for providing materials; Sebastian Eustermann (MRC-LMB) for his tetraloop sequence; Fabrice Gorrec and Sonja Kuhlman for their help at MRC-LMB crystallization facility; Chen Shaoxia, Qing Wang, and Colin Palmer for their aid with electron microscopy at MRC-LMB; Sonja Dunbar for summer work and Ramona Duman (both MRC-LMB) for help at the European Synchrotron Radiation Facility (ESRF); and LC Sciences, the ESRF, and Diamond Light Source for their excellent service and support.
Binding Assay:Article Title: Superstructure of the centromeric complex of TubZR C plasmid partitioning systems
Article Snippet: .. Briefly, all proteins were produced in E. coli and purified by chromatography; DNA was either synthesized ( Bt tubC 24), produced by PCR (all other linear DNA), or purified as a plasmid (p tubC ); the Bt tubC aptamer microarray experiment was performed in conjunction with LC Sciences; electron microscopy was carried out using a 2% (wt/vol) uranyl acetate negative stain in an FEI T12 electron microscope; the sequence of Bt tubC 24 was TTTAAGTTTAACTTTCAGTTTACA; Bt TubR C 24 crystals were solved at 7 Å by molecular replacement and confirmed by selenomethionine SAD, whereas Bm TubR crystals were solved at 3.5 Å by selenomethionine SAD; 90° light scattering was carried out at 400 nm using 1.25 μM Bt TubZ, 500 nM TubR, and 125 nM of TubR binding sites in each tubC DNA, except for tubC repeats 4–7, where the concentration was doubled to make the difference from tubC 24 clearly visible. .. We thank Rachel Larsen, Joseph Pogliano (both University of California at San Diego), and Katherine Michie [Medical Research Council Laboratory of Molecular Biology (MRC-LMB)] for providing materials; Sebastian Eustermann (MRC-LMB) for his tetraloop sequence; Fabrice Gorrec and Sonja Kuhlman for their help at MRC-LMB crystallization facility; Chen Shaoxia, Qing Wang, and Colin Palmer for their aid with electron microscopy at MRC-LMB; Sonja Dunbar for summer work and Ramona Duman (both MRC-LMB) for help at the European Synchrotron Radiation Facility (ESRF); and LC Sciences, the ESRF, and Diamond Light Source for their excellent service and support.
Concentration Assay:Article Title: Superstructure of the centromeric complex of TubZR C plasmid partitioning systems
Article Snippet: .. Briefly, all proteins were produced in E. coli and purified by chromatography; DNA was either synthesized ( Bt tubC 24), produced by PCR (all other linear DNA), or purified as a plasmid (p tubC ); the Bt tubC aptamer microarray experiment was performed in conjunction with LC Sciences; electron microscopy was carried out using a 2% (wt/vol) uranyl acetate negative stain in an FEI T12 electron microscope; the sequence of Bt tubC 24 was TTTAAGTTTAACTTTCAGTTTACA; Bt TubR C 24 crystals were solved at 7 Å by molecular replacement and confirmed by selenomethionine SAD, whereas Bm TubR crystals were solved at 3.5 Å by selenomethionine SAD; 90° light scattering was carried out at 400 nm using 1.25 μM Bt TubZ, 500 nM TubR, and 125 nM of TubR binding sites in each tubC DNA, except for tubC repeats 4–7, where the concentration was doubled to make the difference from tubC 24 clearly visible. .. We thank Rachel Larsen, Joseph Pogliano (both University of California at San Diego), and Katherine Michie [Medical Research Council Laboratory of Molecular Biology (MRC-LMB)] for providing materials; Sebastian Eustermann (MRC-LMB) for his tetraloop sequence; Fabrice Gorrec and Sonja Kuhlman for their help at MRC-LMB crystallization facility; Chen Shaoxia, Qing Wang, and Colin Palmer for their aid with electron microscopy at MRC-LMB; Sonja Dunbar for summer work and Ramona Duman (both MRC-LMB) for help at the European Synchrotron Radiation Facility (ESRF); and LC Sciences, the ESRF, and Diamond Light Source for their excellent service and support.
Spectrophotometry:Article Title: MicroRNAs That Contribute to Coordinating the Immune Response in Drosophila melanogaster
Article Snippet: At 0, 1, 7.5, 18, and 60 hr following injection, total RNA was purified from 10 females using the Total RNA Purification Plus Kit (Cat. No. 48400; Norgen Biotek). .. Next, 5 μg of total RNA (quantified using a NanoDrop 1000 spectrophotometer) from each sample was suspended in 200 μl of precipitation solution (3 M NaOAc, pH 5.2 and 100% ethanol) and immediately frozen in liquid nitrogen; these were stored at −80° until shipment for the miRNA microarray experiment (LC Sciences, Houston, TX). ..
|
